l’m Humanity

imhumanity

Exhibition of “I’m Humanity” genetically-modified microorganism

Grand Prize – Artistic Exploration: Für künstlerische Erforschung und Kunstwerke, bei denen die Aneignung durch die Kunst großes Potenzial zur Beeinflussung und Veränderung von Technologie und deren Nutzung, Entwicklung und Wahrnehmung hat.

Etsuko Yakushimaru

Das Projekt I’m Humanity basiert auf der Idee einer „posthumanitären Musik“ und erforscht, wie neue Musik gesungen oder gespielt, übertragen, aufgezeichnet und variiert sowie in der Folge als Partitur, via Radio, Schallplatten und CDs oder Cloud Computing verbreitet werden kann. Musik bewegt sich durch Zeit und Raum und verändert sich auf dieser klanglichen Reise. Die enge Beziehung zwischen Musik und Medien, zwischen Übertragung und Aufzeichnung in diesem Prozess gleicht jener zwischen den Genen und der DNA. Yakushimaru ist in vielen Genres von Popmusik bis hin zu experimenteller Musik tätig und arbeitet darüber hinaus in unterschiedlichsten künstlerischen Medien: Sie zeichnet, macht Installationen, realisiert Projekte, bei denen Satelliten und biometrische Daten zum Einsatz kommen, entwickelte einen Songs generierenden Roboter und beschäftigt sich mit Instrumentenbau.

Für das Projekt I’m Humanity komponierte Yakushimaru einen Popsong mithilfe der Nukleinsäuresequenz des Synechococcus, einer Gattung der Blaualgen (Cyanobakterien). Die musikalischen Informationen wurden in einem genetischen Code verschlüsselt, der zur Erzeugung einer langen DNA-Sequenz verwendet wurde, die drei miteinander verbundene Nukleinsäuresequenzen enthält. Die DNA wurde künstlich hergestellt und in die Chromosome des Mikroorganismus eingepflanzt. Dieser genetisch modifizierte Mikroorganismus mit Musik in seiner DNA kann sich kontinuierlich selbst replizieren. Selbst wenn die Menschheit, so wie wir sie kennen, aussterben sollte, wird er weiter leben und darauf warten, dass die Musik in seiner DNA von der Spezies, die die Menschheit ersetzt haben wird, gespielt wird.

Was die Lebensdauer von Aufnahmemedien betrifft, so halten CDs angeblich ein paar Jahrzehnte, säurefreies Papier überdauert immerhin Jahrhunderte. Die Lebensdauer der DNA beläuft sich in physikalisch-chemischer Betrachtung im Vergleich dazu auf 500.000 Jahre. Allein aufgrund ihrer langen Lebensdauer eignet sich die DNA daher ideal als Aufnahmemedium.

Biotechnische Verfahren

In unserer DNA, die sich aus vier Nukleotid-Typen (A, C, G und T) zusammensetzt, wird jede Aminosäure von drei Nukleotiden (Triplett) kodiert. Die Translationsregeln sind in der Codon-Tabelle zusammengefasst. Auf Basis dieser Codon-Tabelle zur Anwendung für lebende Zellen wurde ein Verschlüsselungsalgorithmus kreiert, um die Musikakkorde in genetische Codes umzuwandeln. Die Akkordfolge von I’m Humanity wurde in die folgenden 276 Nukleotide umgewandelt:

I’m Humanity: 276bp; A 22; T 101; G 57; C; 96 (GC-Gehalt = 55.4%)

GGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCC

CATGGTCTTCCCCATGGTCTTCCCCATTCTTCTGGAGGATCTTCTGGAGGATCTTCTTTGGGTTCTTCT

GGAGGCGGTCTTCCCCATGGTCTTCCCCATCTTCTTCTTCTTGGTGGTGGTGGTATTCTTCTTCTCGGT

GGTCCCACTGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCAT

Der genetische Code wurde mithilfe eines DNA-Synthesizers automatisiert hergestellt und in einen Vektor mit der Bezeichnung pSyn_1 eingefügt. Die in das eingefügte DNA-Fragment kodierten Musikakkorde wurden mittels homologer Rekombination in das Genom einer Wirtszelle integriert (ein Cyanobakterium, Synechococcus elongatus PCC 7942). Die Musikakkorde im Synechococcus-Genom können im Zuge der Zellteilung endlos reproduziert werden.

“I’m Humanity” genetically-modified microorganism

Etsuko Yakushimaru with “I’m Humanity” in culture

Etsuko Yakushimaru drew pictures on petri dishes using genetically modified microorganisms and cultured them

Etsuko Yakushimaru with “I’m Humanity” in culture

Allerdings kommt es des Öfteren vor, dass Nukleinsäuresequenzen mutieren, was natürlich Veränderungen der genetischen Information bewirkt. In der Geschichte der „Verbreitung von Musik“ spielte „Mutation“, Veränderung, neben der „Übertragung“ von Information eine wesentliche Rolle. Die „Mutation“ von Nukleinsäuresequenzen zeigt eine auffallende Ähnlichkeit zu diesem Vorgang.

Der Mikroorganismus I’m Humanity singt die Textzeile “Stop the evolution―don’t stop it.” Zwar treibt Mutation die Evolution an, doch impliziert dies auch, dass eine Spezies sich verändert. Vielleicht ist I’m Humanity hin- und hergerissen zwischen dem Wunsch nach Evolution und der Angst, dass diese den Verlust von Nukleinsäuresequenzen mit musikalischer Information bedeuten könnte und es I’m Humanity in der Folge unmöglich wäre, sein Lied weiter zu singen.

“I’m Humanity” Live performance at Yamaguchi Center for Arts and Media

“I’m Humanity” Live performance at Yamaguchi Center for Arts and Media

The transposon (the genes that transfer on the genome and cause mutatuin) based on the DNA of Synechococcus, was planted in the score og „I’m Humanity“. In this performance, that segment was performend in an arrangement to make it seem like actual mutation was taking place.
I’m Humanity ist der erste Song in der Geschichte der Menschheit, der in drei Formaten –digitale Musikdistribution, CD und genetisch modifizierter Mikroorganismus – erscheint. Dieser unter Einsatz von Biotechnologie produzierte Song wurde als Popmusik veröffentlicht und brachte es auch auf die Startseite von Apple Music.

“I’m Humanity” digital music artwork

“I’m Humanity” genetically-modified microorganism

“I’m Humanity” CD artwork (CD in the UV-printed petri dish)

“I’m Humanity” on the Apple Music top page of September 2016

Credits

Produktion & Leitung von I’m Humanity: Etsuko Yakushimaru

Text: Tica Alpha (a.k.a Etsuko Yakushimaru)
Musik: Tica Alpha (a.k.a Etsuko Yakushimaru)
Genetische Codes: Etsuko Yakushimaru
Künstlerische Leitung & Zeichnung & Design: Etsuko Yakushimaru
(C) 2016 Yakushimaru Etsuko

Musikalisches Arrangement: Etsuko Yakushimaru, Motoki Yamaguchi
Gesang & Chor & Programmierung & dimtakt (Instrument von Yakushimaru): Etsuko Yakushimaru
Schlagzeug & Programmierung: Motoki Yamaguchi
Aufnahme- & Mischtechnik: Yujiro Yonetsu
Mastering: Shigeo Miyamoto
Technische Unterstützung: Satoshi Hanada
Fotografie & Film: MIRAI seisaku / Photograph(Compact Disc): Satomi Haraguchi
Label: MIRAI records
(P) MIRAI records
Unterstützung & Dank: KENPOKU ART 2016, METI Ministry of Economy, Trade and lndustry., National Institute of Technology and Evaluation (NITE), Satoshi Hanada, Tokyo Metropolitan University, FabCafe MTRL, Yamaguchi Center for Arts and Media [YCAM]
*Apple Music ist eine in den USA und anderen Ländern eingetragene Marke des Technologieunternehmens Apple Inc.

Etsuko Yakushimaru (JP) ist Künstlerin, Musikerin, Produzentin, Texterin, Komponistin, Arrangeurin und Sängerin. Ihr vielseitiges Repertoire reicht von Popmusik bis hin zu experimenteller Musik und Kunst. In ihren weitreichenden künstlerischen Aktivitäten, zu denen auch Zeichnen, Installationskunst, Medienkunst, Poesie und andere literarische Gattungen sowie Rezitation zählen, widersetzt sie sich jeder Vereinnahmung. Sie realisiert zahlreiche Projekte und fördert andere KünstlerInnen, etwa mit ihrer Band Soutaiseiriron. Yakushimaru ist mit zahlreichen Hits in den Musikcharts vertreten, machte sich aber auch mit Projekten, die den Einsatz von Satelliten, biologischen Daten und Biotechnologie involvierten, einem Songs generierenden Roboter, der mit künstlicher Intelligenz und ihrer eigenen Stimme ausgestattet ist, einem unabhängig entwickelten KR-System und elektronischen Musikinstrumenten einen Namen. In jüngerer Zeit hatte sie mehrere Ausstellungen, u.a. im Mari Art Museum, im Toyota Municipal Museum of Art, beim Festival KENPOKU ART 2016 und im Yamaguchi Center for Arts and Media [YCAM]. Ihre Alben Tensei Jingle sowie Flying Tentacles, die beide  2016 herauskamen, wurden von renommierten Kollegen wie Ryuichi Sakamoto, Jeff Mills, Fennesz, Penguin Cafe, Kiyoshi Kurosawa und Toh EnJoe hochgelobt.

Jury Statement

Etsuko Yakushimaru steht beispielhaft für eine neue Generation junger KünstlerInnen, die sich frei zwischen den Welten der Kunst, der Popkultur, der Performance, der Wissenschaft und der Technologie bewegt. Zu ihren künstlerischen Ausdrucksformen zählen Zeichnung, Installations- und Medienkunst, Poesie und Rezitation. Sie arbeitet mit zahlreichen renommierten MusikerInnen zusammen und ist sie Sängerin der 2006 gegründeten Rockband Soutaiseiriron (Relativitätstheorie), für die sie auch Illustrationen anfertigt, sowie Mitglied der Elektropop-Formation Tutu Helvetica.

Mit ihrem Song I’m Humanity beschreitet Yakushimaru völlig neue Wege, wie Musik übertragen, aufgezeichnet, variiert und verbreitet werden kann. Wir haben es hier mit Popmusik zu tun, die mithilfe der Nukleinsäuresequenz des Synechococcus, einer Gattung der Blaualgen, die es lange in der Präfektur Ibaraki gab, komponiert wurde. Die Künstlerin geht von der Vorstellung aus, dass die Musik in diesem Mikroorganismus, selbst wenn die Menschheit aussterben sollte, von der Spezies, die sie ersetzen wird, mithilfe von Translatationsmethoden, die unsere jetzige Vorstellungskraft sprengen, dekodiert werden kann.

Professor Satoshi Hanada von der Metropolischen Universität Tokio stellte sein Labor zur Verfügung, um die Kultivierung genetisch modifizierter Mikroorganismen zu ermöglichen. Die genetischen Codes (276 Nukleotide) wurden mithilfe eines DNA-Synthesizers automatisiert hergestellt und in einen Vektor mit der Bezeichnung pSyn_1 eingefügt. Die in das eingefügte DNA-Fragment kodierten Musikakkorde wurden mittels homologer Rekombination in das Genom einer Wirtszelle integriert (ein Cyanobakterium, Synechococcus elongatus PCC 7942). Die Musikakkorde im Synechococcus-Genom können im Zuge der Zellteilung endlos reproduziert werden und werden von uns – mit gelegentlich auftretenden Mutationen – kontinuierlich an eine posthumane Spezies weitergegeben.

Seit den jüngsten Entwicklungen in der Biotechnologie sind KünstlerInnen fasziniert von der Möglichkeit der genetischen Veränderung und es gibt mittlerweile viele Projekte, bei denen Algen in Petrischalen verwendet werden oder in unterschiedlicher Form mit genetischer Veränderung gearbeitet wird. Das weite Feld der Biokunst boomt. Auch wenn bereits KünstlerInnen wie die Band OK Go in Zusammenarbeit mit dem Biochemiker Dr. Sri Kosuri oder Charlotte Jarvis in Kooperation mit dem Wissenschaftler Sr. Nick Goldman mit dem Kodieren von Musik in DNA experimentierten, gelang Yakushimaru nach Auffassung der Jury insofern ein Durchbruch, als sie diese Technik dem breiten Publikum der Popwelt näherbrachte. Darüber hinaus unternahm sie gezielt Bemühungen, um mit WissenschaftlerInnen bedeutender Institutionen wie des National Institute of Technology and Evaluation (NITE) und der Metropolischen Universität Tokio zusammenarbeiten zu können.

Die Idee, mit Genen als Medium zu arbeiten, wird hier über DIY-Labs und die elitären Publikumsschichten für experimentelle Kunst hinaus in etablierte Bereiche wie Popkultur und wissenschaftliche Institutionen hineingetragen. Dies verdeutlicht die Fähigkeit einer unvergleichlichen Künstlerin, Brücken zu schlagen, die Grenzen zwischen den Disziplinen zu überschreiten, neue Möglichkeiten zu eröffnen und den Einfluss der wissenschaftlichen Forschung auf das tägliche Leben zu erkennen. Die Jury hofft, dass durch das breite Publikum, das die Künstlerin erreicht, das aufstrebende Feld der Biokunst, an Akzeptanz gewinnt und mehr KünstlerInnen und WissenschaftlerInnen an visionären Projekten zusammenarbeiten, die ungewöhnliche Wege beschreiten und auf diese Weise möglicherweise bahnbrechende Innovationen in Kunst und Wissenschaft hervorbringen.